We would like to congratulate Dr. Mark Bayfield from York University, who won a 500$ credit for services offered by Génome Québec. We would like to thank everyone that filled out the annual survey.

Frequently asked questions

Questions related to sequencing

Samples Submission
  1. How should I physically organise my samples and/or primers when I send them to the Sequencing Service?
  2. What quantity/concentration of DNA should I provide for sequencing?
  3. What quantity/concentration of primer should I provide for sequencing?
  4. What are the primers provided by the Sequencing Service?
  5. Which options should I choose when I submit my samples via Nanuq to obtain the correct form (step 1 of the submission)?
Results
  1. Once my samples have been received and accepted by the Sequencing Service how long does it take to see my sequences on Nanuq?
  2. How can I view and analyse my sequences?
  3. What length should I expect from the sequences?
  4. What can I do if my sequencing results are of poor quality?
  5. The text version of the sequence from Nanuq is different than the chromatogram. Why?
Billing
  1. Should I provide a purchase order or credit card number when submitting my samples?
  2. To whom should I send my payment?
Nanuq
  1. Which Internet browsers are compatible with Nanuq?
Answers - Questions related to sequencing
Samples Submission
  1. How should I physically organise my samples and/or primers when I send them to the Sequencing Service?

    The best way to organise samples and/or primers submitted in PCR strip tubes is to regroup all samples (plasmids, PCR products, phage or BAC) one after the other. The tubes must be properly labelled with the corresponding well ID on the Sample Submission Form: A01, A02, A03, etc.

    The primers must be aliquoted in PCR strip tubes in the same order as their associated DNA samples.

    The best way to organise samples and/or primers submitted in a 96-well plate is to regroup all samples (plasmids, PCR products, phage or BAC) one after the other starting with well A01 progressing sequentially to A02, A03 to A12, B01 to B12 and so on. The primers may be aliquoted on the same plate however they must be aliquoted after the full set of samples, beginning in the row below the last samples. If there are not enough empty wells on the plate use a new properly identified plate.

    Samples and primers must be organized in exactly the same positions as indicated in your Sample Submission Form.

    It is important to note :

    • A sample to be sequenced with more than one primer must be aliquoted in as many tubes/wells as there are different primers.
    • A single submission can contain multiple types of DNA, such as, plasmid DNA, purified and non-purified PCR product, phage and BAC DNA. The samples however must be grouped by DNA type.
    • All samples to be sequenced with primers provided by the Sequencing Service must be grouped together.

    Download examples

    You must complete plate 1 of the Sample Submission Form before beginning plate 2.

    Back to top
  2. What quantity/concentration of DNA should I provide for sequencing?

    Volume and concentration required per sequencing sample:

    Volume Concentration
    Length of PCR product Concentration estimate on agarose gel
    Unpurified PCR 20 µl minimum 100-200 pb
    200-500 pb
    500-1000 pb
    1000-2000 pb
    2000 pb    		 0.5-1.5 ng/µl
    1.5-5 ng/µl
    2-10 ng/µl
    5-20 ng/µl
    20-50 ng/µl
    Purified PCR 5 µl minimum
    Plasmid DNA or phage 5 µl minimum 100-500 ng/µl
    BAC/PAC end sequencing 20 µl minimum 500 ng/µl minimum
    Back to top
  3. What quantity/concentration of primer should I provide for sequencing?

    Concentration and volume required per sequencing sample:

    Volume Concentration
    Primer 10 µl 5 µM
    Back to top
  4. What are the primers provided by the Sequencing Service?

    The Sequencing Service provides the following standard set of common primers free of charge:

    T7 5' - TAATACGACTCACTATAGGG - 3'
    T3 5' - AATTAACCCTCACTAAAGGG - 3'
    SP6 5' - TATTTAGGTGACACTATAG - 3'
    M13 forward 5' - GTAAAACGACGGCCAGT - 3'
    M13 reverse 5' - GGAAACAGCTATGACCATG - 3'
    BGH reverse 5' - TAGAAGGCACAGTCGAGG - 3'
    T7 terminateur 5' - GCTAGTTATTGCTCAGCGG - 3'
    pGEXF 5' - GGGCTGGCAAGCCACGTTTGGTG - 3'
    pGEXR 5' - CCGGGAGCTGCATGTGTCAGAGG - 3'
    Back to top
  5. Which options should I choose when I submit my samples via Nanuq to obtain the correct form (step 1 of the submission)?

    To the question 'What type of service is required?' answer 'DNA preparation' only if you are submitting fresh bacterial colonies or glycerol stocks. If you are submitting extracted plasmids, PCR products (purified or not), phage or BAC answer 'Sequencing'.

    Answer NO to the question 'Will you be using our SNP discovery service post sequencing?'. For more information about this service, please contact the sequencing platform's director Pierre Lepage at 514-398-3311 extension 00346 or by email.

    Lastly, answer the following question 'What kind of container(s) are you using?' and download the form.

    Back to top
Results
  1. Once my samples have been received and accepted by the Sequencing Service how long does it take to see my sequences on Nanuq?

    Once the samples are accepted, the normal delay for sequencing is from 2 to 4 days.

    Back to top
  2. How can I view and analyse my sequences?

    From your account on Nanuq's home page click on your project name listed under the heading 'Project Data/Results'. Choose the submission number corresponding to the sequences you wish to view and click on the corresponding sequencing date.

    You are now able to look at the chromatogram by clicking on 'T' (trace) or view the text version of the sequence by clicking on the length of the sequence.

    It is also possible to download the chromatogram(s) (AB1 or SCF format) or the text version of the sequence by choosing 'Search/Download Data' under the heading 'tools' in the top menu.

    Back to top
  3. What length should I expect from the sequences?

    Samples of good quality at the recommended concentration usually generate up to 800 bases of good quality sequence.

    Back to top
  4. What can I do if my sequencing results are of poor quality?

    Once you have verified the quantity and quality of your samples, do not hesitate to contact the Sequencing Service group for help.

    Sequencing Service
    514-398-3311 ext: 00522
    email

    Back to top
  5. The text version of the sequence from Nanuq is different than the chromatogram. Why?

    It is essential to look at the actual chromatogram to verify the quality of your sequence. The base calling program identifies all bases and occasionally misidentifies bases of poor quality, such as the first 40 bases following the primer and the end of the sequence.

    Therefore the use of the 'Mask the sequence' function is highly recommended when looking at the text version of a sequence in Nanuq. This function is listed in the menu to the left under 'Manipulation'. It masks the bases that are under a selected quality threshold (15 by default). Those bases will be replaced by an 'N'.

    Back to top
Billing
  1. Should I provide a purchase order or credit card number when submitting my samples?

    First and foremost, it is very important to indicate your chosen method of payment when opening an account. This is done in the Sequencing Request Form under the section 'Method of Payment'.

    If you wish to pay by cheque, the purchase order (PO) number is required for all sample submissions. Enter the PO number in row 15 of the sample submission sheet.

    If you wish to pay by credit card, it is not necessary to provide your credit card number when you are submitting samples. It will be requested upon invoicing.

    Back to top
  2. To whom should I send my payment?

    Payments can only be made by cheque or credit card. A purchase order (PO), requisition, or account number can be added to your invoice upon request.

    The cheque must be made to the order of Génome Québec and sent to:

    Génome Québec
    630, boulevard René-Lévesque
    Suite 2660
    Montréal (Québec)
    Canada H3B 1S6

    Back to top
Nanuq
  1. Which Internet browsers are compatible with Nanuq?

    The main compatible Internet browsers for both MACs and PCs are:

    • Firefox version 1.0.7 and up
    • Explorer version 6.0 and up
    Back to top