Nouveaux prix de services à la baisse en vigueur le 1er septembre 2017. Contactez-nous à infoservices@genomequebec.com pour plus de détails.

Foire aux questions

Envoi des échantillons
  1. Comment dois-je physiquement organiser mes échantillons et/ou mes amorces lorsque je les envoie au service de séquençage?
  2. Quelle quantité/concentration d'ADN dois-je fournir pour le séquençage?
  3. Quelle quantité/concentration d'amorce dois-je fournir pour le séquençage?
  4. Quelles sont les amorces fournies par le service de séquençage?
  5. Quelles options dois-je choisir lors de la soumission d'échantillons via Nanuq pour obtenir le bon formulaire (étape 1 de la soumission)?
Résultats
  1. Une fois mes échantillons reçus et acceptés par le service de séquençage, quel est le délai pour voir mes séquences sur Nanuq?
  2. Comment voir et analyser mes séquences?
  3. Quelle est la longueur des séquences obtenues?
  4. Que puis-je faire si mes séquences sont de mauvaise qualité?
  5. La séquence texte obtenue dans Nanuq diffère du chromatogramme. Pourquoi?
Facturation
  1. Dois-je fournir un numéro de bon de commande ou de carte de crédit lors de la soumission de mes échantillons?
  2. À qui doit-on envoyer le paiement?
Nanuq
  1. Quels sont les navigateurs Internet compatibles avec Nanuq?
Réponses
Envois des échantillons
  1. Comment dois-je physiquement organiser mes échantillons et/ou mes amorces lorsque je les envoie au service de séquençage?

    Si les échantillons et/ou les amorces sont soumis dans les tubes PCR en "strip" la meilleure façon de les organiser est de regrouper tous les échantillons (plasmides, produits de PCR, phage ou BAC) les uns à la suite des autres en identifiant correctement les tubes par le nom des puits correspondant sur le Formulaire de soumission d'échantillons : A01, A02, A03, etc.

    On procède de la même façon avec les amorces qui doivent être aliquotées dans les tubes PCR en "strip" dans le même ordre que les échantillons auxquels elles correspondent.

    Si les échantillons et/ou les amorces sont soumis dans une plaque de 96 puits, la meilleure façon de les organiser est de regrouper tous les échantillons (plasmides, produits de PCR, phage ou BAC) les uns à la suite des autres en commençant par le puits A01 et en suivant l'ordre de la plaque, c'est-à-dire de A01 à A12, B01 à B12 et ainsi de suite.

    Les amorces peuvent être aliquotées dans la même plaque dans les rangées inférieures si l'espace le permet ou dans une autre plaque clairement identifiée.

    Les échantillons et les amorces doivent être organisés exactement comme sur votre Formulaire de soumission d'échantillons.

    De plus, il est important de noter que :

    • Si un échantillon doit être séquencé avec deux amorces ou plus, l'échantillon doit être aliquoté dans autant de tubes (ou puits) qu'il y a d'amorces.
    • Si une amorce doit être utilisé pour deux échantillons ou plus, l'amorce doit être aliquotée dans autant de tubes (ou puits) qu'il y a d'échantillons à séquencer.
    • Si les échantillons soumis sont de différents types (plasmides, PCR purifies, PCR non purifies, phage ou BAC), veuillez regrouper les échantillons par type d'ADN soumis.
    • Si une partie des amorces requises sont des amorces fournies par le service de séquençage, veuillez regrouper les échantillons correspondants.

    Télécharger les fichiers d'exemple

    Vous devez remplir la plaque 1 du Formulaire de soumission d'échantillons avant de placer des échantillons dans la plaque 2.

  2. Quelle quantité/concentration d'ADN dois-je fournir pour le séquençage?

    Les volumes et quantités requis par échantillon à séquencer sont:


    Volume Concentration
    Produits de PCR non purifiés 20 µl minimum Les amplifications PCR doivent ?tre v?rifi?es par migration sur gel d'agarose et une copie de la photo du gel doit ?tre envoy?e au Service de s?quen?age avec les ?chantillons.

    Les produits de PCR de moins de 250 pb donnent des s?quences de moindre qualit? en raison d'un ph?nom?ne de saturation (plus les fragments sont petits plus ils sont, en g?n?ral, concentr?s et plus le signal de la s?quence obtenue est intense) et de compression des bases qui se produit au d?but et ? la fin de toutes les s?quences (ph?nom?ne reli? ? l'?lectrophor?se en capillaires des s?quenceurs 3730xl d'ABI).

    Des produits de PCR de plus de 2000 pb pourraient ?tre difficiles ? s?quencer, la concentration d'ADN devenant un facteur limitant. En effet plus un produit de PCR est long plus sa concentration doit ?tre ?lev?e pour obtenir un r?sultat de s?quen?age satisfaisant.
    Produits de PCR purifiés 7,5 µl minimum
    ADN plasmidique ou phage 7,5 µl minimum 100-500 ng/µl
    Extrémités de BAC/PAC 20 µl minimum 500 ng/µl minimum
  3. Quelle quantité/concentration d'amorce dois-je fournir pour le séquençage?

    Les volume et quantité requis par échantillon à séquencer sont:

    Volume Concentration
    Amorce 10 µl 5 µM
  4. Quelles sont les amorces fournies par le service de séquençage?

    Le service de séquençage offre gratuitement les amorces universelles suivantes:

    T7 5' - TAATACGACTCACTATAGGG - 3'
    T3 5' - AATTAACCCTCACTAAAGGG - 3'
    SP6 5' - TATTTAGGTGACACTATAG - 3'
    M13 forward 5' - GTAAAACGACGGCCAGT - 3'
    M13 reverse 5' - GGAAACAGCTATGACCATG - 3'
    BGH reverse 5' - TAGAAGGCACAGTCGAGG - 3'
    T7 terminateur 5' - GCTAGTTATTGCTCAGCGG - 3'
    pGEXF 5' - GGGCTGGCAAGCCACGTTTGGTG - 3'
    pGEXR 5' - CCGGGAGCTGCATGTGTCAGAGG - 3'
  5. Quelles options dois-je choisir lors de la soumission d'échantillons via Nanuq pour obtenir le bon formulaire (étape 1 de la soumission)?

    à la question « Quel type de service est requis? » répondez « Préparation d'ADN » uniquement si vous soumettez des colonies bactériennes fraîches ou des stocks de glycérol. Répondez « Séquençage » si vous soumettez des plasmides déjà extraits, des produits de PCR (purifiés ou non), des phages ou des BAC.

    Répondez NON à la question « Comptez-vous utiliser notre service de découverte de SNP post séquençage? ». Si toutefois vous désirez avoir de l'information sur ce service, veuillez communiquer avec le directeur du service de séquençage Pierre Lepage au 514-398-3311 poste 00346 ou par courriel.

    Finalement répondez à la question « Quel type de contenant utilisez-vous? » et téléchargez le formulaire.

Résultats
  1. Une fois mes échantillons reçus et acceptés par le service de séquençage, quel est le délai pour voir mes séquences sur Nanuq?

    Une fois les échantillons acceptés, le délai normal de séquençage est de 2 à 4 jours.

  2. Comment puis-je voir et analyser mes séquences?

    Dans la page d'accueil de Nanuq, cliquez sur votre nom de projet sous « Résultats/données du projet ». Choisissez le numéro de lot de soumission correspondant aux séquences que vous voulez voir et cliquez sur la date de séquençage correspondante.

    Vous pouvez alors regarder le chromatogramme en cliquant sur T (sous trace) ou regarder la séquence texte en cliquant sur la longueur de la séquence.

    Il est possible de télécharger le(s) chromatogramme(s) (format AB1 ou SCF) ou la séquence texte en choisissant « Recherche/Téléchargement données » sous l'onglet outils du menu du haut.

  3. Quelle est la longueur des séquences obtenues?

    A partir d'échantillons de bonne qualité et en quantité suffisante, les séquences obtenues devraient être de bonne qualité jusqu'à 800 pb.

  4. Que puis-je faire si mes séquences sont de mauvaise qualité?

    Une fois que vous avez vérifié la quantité et la qualité de vos échantillons, n'hésitez pas à communiquer avec le service de séquençage afin d'obtenir de l'aide pour tenter d'améliorer vos résultats.

    Service de Séquençage
    514-398-3311 Poste 00522
    courriel

  5. La séquence texte obtenue dans Nanuq diffère du chromatogramme. Pourquoi?

    Il est essentiel de toujours regarder le chromatogramme afin de vérifier la qualité de votre séquence. Le programme qui effectue l'attribution des bases peut, lorsque la séquence est de mauvaise qualité, mal identifier certaines bases (par exemple de début et fin des séquences).

    Il est donc fortement recommandé d'utiliser la fonction « Masquer la séquence » lorsque vous regardez la séquence en version texte dans Nanuq (dans le menu de gauche, sous l'onglet « Manipulation »). Cette fonction permet de masquer les bases de qualité inférieure au seuil de qualité choisi (15 par défaut). Ces bases seront remplacées par un « N ».

Facturation
  1. Dois-je fournir un numéro de bon de commande ou de carte crédit lors de la soumission de mes échantillons?

    Avant tout, il est important d'indiquer le mode de paiement que vous souhaitez utiliser dans la section « Mode de Paiement » du formulaire de demande de séquençage (lors de l'ouverture de compte).

    Si vous vous désirez payer par chèque, le numéro de bon de commande est requis pour chaque soumission d'échantillons. Un espace est prévu à cette fin à la ligne 15 du fichier Excel de soumission d'échantillons (Numéro de bon de commande).

    Si vous désirez payer par carte de crédit, il n'est pas nécessaire de fournir le numéro de carte de crédit au moment de la soumission des échantillons. Il vous sera demandé ultérieurement lors de la facturation.

  2. À qui doit-on envoyer le paiement?

    Suivez le lien pour en connaître d'avantage sur les paiements.

Nanuq
  1. Quels sont les navigateurs Internet compatibles avec Nanuq?

    Les principaux navigateurs Internet compatibles avec Nanuq (pour MAC et PC) sont :

    • Firefox version 1.0.7 et plus
    • Explorer version 6.0 et plus