New lower prices for services effective September 1st 2017. Contact us at infoservices@genomequebec.com for more details.

Questions

Contact

Client Management Office

Frédérick Robidoux, B.Sc.
Sharen Roland, B.Sc.
Philippe Daoust, M.Sc.

McGill University and Génome Québec Innovation Centre
740, Dr. Penfield Avenue, Room 7104
Montréal (Québec) Canada
H3A 0G1

Phone: 514-398-7211
Fax: 514-398-1790
Email: infoservices@genomequebec.com

Frequently Asked Questions

Display Mode

General questions

Frequently asked questions and answers for this section are not yet available. You may address your questions directly to Client Management Office

Questions related to Nanuq

Nanuq
  1. I have lost my Nanuq User name or Password. What should I do?
  2. When I try to access Nanuq, I get a message to the effect that the connection I am trying to establish poses security problems. Why so and what should I do?
  3. Nanuq does not connect. What should I do?
  4. I would like to have access to Nanuq. Who should I contact?
  5. What is Nanuq?
  6. I have requested data through Nanuq and I never received an e-mail stating that the data was ready to be downloaded. What is the problem?
  7. Nanuq does not work properly. What should I do?
  8. I am not able to submit the Request form for sequencing. How can I send it to you?
  9. I cannot download my genotyping report with the link I have received by e-mail. What is happening?
  10. I have made a request for hybridization results, for which I have received an email stating that the data is available on Nanuq. However, I cannot see them. What is happening?
  11. Following a Nanuq access request, I have received an e-mail with my User name and Password. But I cannot connect because Nanuq does not recognize me. What is happening?
  12. I cannot submit the Excel spreadsheet for my sequencing samples. What is the problem?
  13. I sent the request to Nanuq, and I have not heard anything. What is happening?
Answers - Questions related to Nanuq
Nanuq
  1. I have lost my Nanuq User name or Password. What should I do?

    On the Nanuq Home Page, click on the link "Lost password", and write the e-mail address associated with your account

  2. When I try to access Nanuq, I get a message to the effect that the connection I am trying to establish poses security problems. Why so and what should I do?

    This message is normal. Indeed, even if Nanuq used a secure connection (https not http), we do not have a certificate produced by a recognized authority (e.g. VeriSign), which is the cause of this warning. Simply accept the connection and, eventually, add the Nanuq site to the list of authorized sites in your favorite browser.

  3. Nanuq does not connect. What should I do?

    First, verify if your internet connection is working. If so, contact Nanuq Technical Support by e-mail or at 514-398-3311 #00173. Give as much information as possible (e.g. the symptoms: white page, error message, no response; the content of the error message if there is one, which browser you are using, etc).

  4. I would like to have access to Nanuq. Who should I contact?

    You should discuss this directly with the service with which you are conducting projects. The coordinates of each of these services are available on the contact page.

  5. What is Nanuq?

    Nanuq is the web portal by which you can access the data produced in the course of your projects at the McGill University and Génome Québec Innovation Centre. Consult the following link for a more detailed description of Nanuq.

  6. I have requested data through Nanuq and I never received an e-mail stating that the data was ready to be downloaded. What is the problem?

    There are several potential causes for this problem.

    1. The e-mail is sent to the e-mail address associated with the Nanuq account used to make the request. Make sure to look at this e-mail address. To verify which address is on the account, click on the link "My profile" on the Nanuq Home Page.
    2. The e-mail was indeed sent, but was intercepted by your e-mail server. Look into your junk mail, in the deleted items or elsewhere. If you find it, add the sender to the list of approved senders to avoid this problem in the future.
    3. There was a problem on the side of Nanuq. Contact Nanuq Technical Support.
  7. Nanuq does not work properly. What should I do?

    Contact Nanuq Technical Support by e-mail or at 514-398-3311 #00173. Give as much information as possible, (e.g. the symptoms: white page, error message, no response; the content of the error message if there is one, which browser you are using, etc).

  8. I am not able to submit the Request form for sequencing. How can I send it to you?

    Send it by e-mail directly to the Client Management Office.

  9. I cannot download my genotyping report with the link I have received by e-mail. What is happening?

    There are several possible causes, but the most probable one is the following. The report has already been downloaded a first time. In this case, it is unfortunately not available anymore and one has to request it again. If this is not the case, contact Nanuq Technical Support by e-mail or at 514-398-3311 #00173. Give as much information as possible (e.g. the symptoms: white page, error message, no response; the content of the error message if there is one, which browser you are using, etc).

  10. I have made a request for hybridization results, for which I have received an email stating that the data is available on Nanuq. However, I cannot see them. What is happening?

    There are several possible causes, but the most probable one is the following. Data is kept and made available for 7 days. After this, it will unfortunately not be available anymore and one has to request it again. If this is not the case, contact Nanuq Technical Support by e-mail or at 514-398-3311 #00173. Give as much information as possible (e.g. the symptoms: white page, error message, no response; the content of the error message if there is one, which browser you are using, etc).

  11. Following a Nanuq access request, I have received an e-mail with my User name and Password. But I cannot connect because Nanuq does not recognize me. What is happening?

    There are several possible causes, but the most probable one is the following. A typographical error might have been made when entering the user name and/or password. For example, there is confusion between I (capital I), l (small L) and 1 (number 1). If you have used cut-and-paste, make sure not to have included spaces at the beginning or the end. If the problem remains, click on the link "Lost password" to request a new password. If the problem remains, contact Nanuq Technical Support by e-mail or at 514-398-3311 #00173. Give as much information as possible (e.g. the symptoms: white page, error message, no response; the content of the error message if there is one, which browser you are using, etc).

  12. I cannot submit the Excel spreadsheet for my sequencing samples. What is the problem?

    There are several potential causes for this problem.

    1. Make sure you are using the correct version of the form. To ensure this, download it from Nanuq instead of using an old saved copy.
    2. Be careful with typographical errors, especially when you are using cut-paste-modify.

    If the problem remains, contact Nanuq Technical Support by e-mail or at 514-398-3311 #00173. Give as much information as possible (e.g. the symptoms: white page, error message, no response; the content of the error message if there is one, which browser you are using, etc).

  13. I sent the request to Nanuq, and I have not heard anything. What is happening?

    Normally, you should receive an acknowledgment in the following minutes or hours from the time of your request. If this is not the case, re-submit your request. You can also call us at 514-398-3311 #00173.

    If you have received an acknowledgment, but have not received a response, you can follow up by clicking on ("Reply") to the previously received acknowledgment. You can also call us at 514-398-3311 #00173.

Questions related to cytogenetics - CNV

Frequently asked questions and answers for this section are not yet available. You may address your questions directly to Client Management Office

Questions related to functional genomics

  1. What kind of samples can we submit?
  2. What method should be employed to isolate my RNAs?
  3. What is the procedure if the cRNA yield is insufficient or if the cRNA quality is bad?
  4. How much RNA is necessary for a project?
  5. How many samples should be submitted?
  6. What is the RIN?
  7. How can I interpret a Bioanalyzer profile?
  8. What is the turnaround time?
  9. How to access my data?
  10. Who can access my data?
  11. How long will my data be available?
  12. How should I proceed once I download my data?
  13. Do I have to cite the Innovation Centre if I publish my research?
  14. What is the difference between the three expression profiling technologies offered?
  15. Is it recommended to compare data obtained at different times?
  16. Is it possible to compare data obtained by different technologies?
  17. Can I have my data analyzed at the Innovation Centre?
  18. Should I include sample replicates in my project?
  19. Is it mandatory to send samples on dry ice?
  20. Can I have my samples sent back to me?
  21. Why do the sample names change once they are in Nanuq?
  22. Which tests are included in the RNA QCs?
Answers - Questions related to functional genomics
  1. What kind of samples can we submit?
  2. Only total RNA samples are accepted.

  3. What method should be employed to isolate my RNAs?
  4. We get excellent quality results with RNA samples isolated using commercial kits such as Qiagen. If your extraction protocol uses Trizol, a cleanup using Qiagen column should be done. This cleanup could be performed by the expression team if the user doesn't want to.

  5. What is the procedure if the cRNA yield is insufficient or if the cRNA quality is bad?
  6. An in-house control sample is always run alongside the users' samples. A problematic sample will be redone free of charge if our in-house control and the user samples present the same problem. However, if nothing is wrong with the control sample, the user will be asked to decide if:

    • The Innovation Centre should go ahead and hybridize all the cRNAs "as-is", knowing that the poor quality of the cRNAs sample could affect the final results. If the cRNA yield is low, all cRNAs can be normalized according to the low-yield sample. In this case, the Innovation Centre cannot guarantee a good hybridization outcome.
    • The Innovation Centre should redo the protocol with the problematic sample. If the outcome is the same, the user will have to assume the cost of the redo. There is no charge for the redo if the new cRNA is good.
    • A replacement sample should be sent.
    • The problematic sample should be dropped from the study.
  7. How much RNA is necessary for a project?
  8. The total RNA requirements are different for each technology:

    Agilent Affymetrix Illumina
    Minimum Quantity 8-samples arrays: 25ng
    4-samples arrays: 50ng
    3'arrays: 250ng
    ST arrays: 100ng
    250ng
    Minimum Volume 1.5 µl 3 µl 11 µl

    3 µl of total RNA are needed for the Quality Control tests and are not included in the volumes indicated in the above table. Moreover, it is better to submit enough material to run the experiment twice in case of a technical problem.

  9. How many samples should be submitted?
  10. The number of samples submitted depends on the technology platform and array type chosen. For example, only multiples of 12 are accepted for Illumina Human HT-12 arrays. We accept a minimum number of samples for each technology:

    Agilent Affymetrix Illumina
    Nombre minimum d'échantillons 8 6 Human HT12 et Mouse WG-6 : 12
    Mouse Ref-8: 8
  11. What is the RIN?
  12. RIN stands for "RNA Integrity Number". The RIN score is calculated by the Bioanalyzer software to determine RNA and DNA integrity. It ranges between 1 and 10; where 10 is the highest score. We do not recommend using samples with an RIN below 7.

  13. How can I interpret a Bioanalyzer profile?
  14. The Bioanalyzer profile of total RNA looks at the 18S and 28S ribosomal RNA peaks where the 28S peak should be higher. The aspect of the baseline flanking the 18S and 28S peaks is also important. It should be as close to 0 as possible and should not present any other peaks. Here are some examples of different quality total RNAs:

  15. What is the turnaround time?
  16. The turnaround time depends on the workload of the platform. Once the required paperwork is completed and we receive the samples, the Quality Control results are made available within 5 working days. If everything goes well, the final results are generally communicated within 10 working days after the reception of your arrays.

  17. How to access my data?
  18. Most of the time, final results are available through Nanuq. In your project page you need to click on "Request experimental data". Once the data are available, an automatic e-mail will be sent. You will have to come back to your project page and click on "Collect experimental data", choose the desired data and download them. If it is not possible to upload the data into Nanuq, they will be made available through a secure ftp site.

  19. Who can access my data?
  20. Only people mentioned on the initial Request Form have access to the data through Nanuq.

  21. How long will my data be available?
  22. Once you click on "Request Experimental Data", the data will be available for 15 days. After 15 days, you will have to request the data again.

    On the secure ftp site, the data will be available for only 10 days.

  23. How should I proceed once I download my data?
  24. The Innovation Centre suggest some analysis softwares for your expression data.

    - MeV (Clustering, standard differential analysis on normalysed data, etc.)
    - Bioconductor (More advanced)
    - Array Analysis
    - Microarray
    - GenomeStudio and "Gene Expression" module (not free)
    - GeneSpring (not free)

  25. Do I have to cite the Innovation Centre if I publish my research?
  26. Yes. Any collaborative work or service performed at the McGill University and Génome Québec Innovation Centre must be acknowledged and communicated to the Innovation Centre. These acknowledgements may take the form of co-authorships of platform personnel on peer-reviewed papers in which the affiliation should be clearly identified, or, the contribution of platform personnel and the Innovation Centre may simply be included in the acknowledgement section of the publications. In the case of oral communications (ex. PowerPoint presentations during scientific meetings), the use of the name Génome Québec and/or its logo is sufficient. An official reprint of each publication should then be forwarded to the Innovation Centre.

  27. What is the difference between the three expression profiling technologies offered?
  28. Agilent Affymetrix Illumina
    Species Several organisms
    Custom arrays available
    3' arrays: several species ST arrays: human, mouse, rat, CHO Mouse and human
    Number of samples Multiples of 4 or 8, depending on the array Minimum of 6 samples, no other restriction Multiples of 6, 8 or 12, depending on the array
    Quantity of starting material 8-samples arrays: 25ng
    4-samples arrays: 50ng
    3' arrays: 250ng
    ST arrays: 100ng
    250ng
    Length of probes 60nt 25nt 50nt
    Copies of each probe 1 probe per gene 3' arrays:
      - 11 copies
    Exon arrays:
      - 4 copies per exon
      - 40 per gene
    Gene ST arrays:
      - 26 copies
    6 et 8-samples:
      - 30 copies
    12-samples arrays:
      - 15 copies
    Isomers detected No 3' arrays: No
    ST arrays: Yes
    Yes
    Probes binding sites 3' 3' arrays: 3'
    ST arrays: different sites throughout the gene
    3'
  29. Is it recommended to compare data obtained at different times?
  30. Several data analysis tools allow such analyses and make it relatively simple. However, processing samples hybridized at different times introduces batch effects which make the analysis less sensitive by increasing the number of false-positives. On the other hand, the analysis specificity is higher because of the decrease of false-negatives.

  31. Is it possible to compare data obtained by different technologies?
  32. It is possible, but it is not recommended. In such comparison, a correspondence between the probes used by each technology must be made. The length, specificity and mapping of the probes being different for each technology make such a comparison very difficult.

  33. Can I have my data analyzed at the Innovation Centre?
  34. Yes, the Innovation Centre offers bioinformatics services which can help you choose the appropriate analysis tool or analyze your data for you.

  35. Should I include sample replicates in my project?
  36. In a gene expression project, the effect of different conditions on the gene expression has to be determined. Therefore, we suggest you submit at least three replicates. The more replicates you have, the more the bioinformatics analysis will be representative and statistically significant. There are two types of replicates: technical and biological. We recommend biological replicates to be used over technical replicates.

  37. Is it mandatory to send samples on dry ice?
  38. Yes. RNA samples are very sensitive to degradation. Therefore, there is a high possibility that samples received unfrozen will be degraded. The Innovation Centre will inform the users immediately when it receives samples with no dry ice. It will then be recommanded to send us replacement samples with more dry ice. We will not run unfrozen RNA samples on the Bioanalyzer unless we are requested to do so by the user.

  39. Can I have my samples sent back to me?
  40. No. The Innovation Centre policy is not to send back samples. Therefore, it is better to send us aliquots. Should the user need the samples to be sent back, an arrangement between the principal investigator and the platform manager must be made and shipping fees will apply.

  41. Why do the sample names change once they are in Nanuq?
  42. We rename all samples received in the Innovation Centre to make sure every sample has a unique name in our database (Nanuq).

  43. Which tests are included in the RNA QCs?
  44. Firstly, we measure the concentration of each RNA sample using a spectrophotometric method (Nanodrop 1000). Secondly, we calculate A260/A230 and A260/A280 ratios which indicate the presence of contaminants that could affect subsequent enzymatic reactions.

    Furthermore, we verify the RNA integrity (RIN) using the Agilent's Bioanalyzer.

Questions related to genotyping

General questions concerning the genotyping services
  1. What is the procedure to request genotyping services?
  2. What are the concentration and quantity of DNA for the sample which should be sent?
  3. If I do not have enough DNA, can I send you whole-genome amplified DNA?
  4. How should I send my DNA samples and primers?
  5. Is there a specific format I should use to create my DNA plate?
  6. Should I create a pedigree for the samples that do not have one?
  7. Is there a specific way to identify the samples?
  8. How will the genotypes be delivered?
  9. What are the validation and production steps?
  10. What are the validation and production genotypes?
  11. How much time is necessary for the completion of genotyping projects?
Questions on the microsatellite genotyping services
  1. How are the microsatellite markers groupings done?
  2. Do the selected SNPs have to be obtained from the Innovation Centre's database, Nanuq?
  3. How should I identify the selected SNPs?
Answers - Questions related to genotyping
General questions concerning the genotyping services
  1. What is the procedure to request genotyping services?

    You must contact the Client Management Office to request a quote. Once the quote is approved, you must fill out the request form, sent it by e-mail (along with a Purchase Order number (PO) and the ethics certificate if samples are of human origin) and send the first page, signed, by fax.

  2. What are the concentration and quantity of DNA for the sample which should be sent?

    The required concentration varies according to the technology used.

    For genotyping of microsatellites, TaqMan or Sequenom® iPLEX, the sent DNA should be in a minimum concentration of 20ng/ul and you need to provide at least 30ul. The quantity required can depend on the amplitude of the project. Ideally, the DNA should be solubilized in ultrapure water.

    For genotyping using the Illumina technology, the DNA should have a minimum concentration of 100ng/ul and the minimum required quantity is 25ul. The DNA should be diluted in a TE buffer (10mM Tris-HCl pH 8.0 / 1mM EDTA). If you prefer, you can send us your lyophilized samples.

  3. If I do not have enough DNA, can I send you whole-genome amplified DNA?

    Even if the genotyping ratio is not significantly different from that of non-amplified DNA, we have observed, for Illumina technologies, that for certain SNPs, the clusters behave differently between amplified and non-amplified DNA. Consequently, it is not recommended to mix amplified and non-amplified DNA samples in a same experiment. Note that if this is the only way to do it, the problematic SNPs will simply be taken out of the analyses.

    In the case of microsatellite technologies, TaqMan or Sequenom® iPLEX, we have not noted particular problems with the use of amplified genomic DNA.

  4. How should I send my DNA samples and primers?

    Samples should be sent in 96-well plates and safely sealed with an appropriate sealer. You must also include a schematic representation of your plate.

  5. Is there a specific format I should use to create my DNA plate?

    Please refer to the 'DNA' section for each technology for all the necessary information regarding the creation of this format.

  6. Should I create a pedigree for the samples that do not have one?

    If your DNA cohort is comprised of unrelated individuals, the creation of a pedigree is unnecessary. However, if your cohort is mostly comprised of samples with a pedigree and only a few unrelated individuals, please insert the unrelated individuals in the pedigree folder. These unrelated individuals will have no link with the other samples.

  7. Is there a specific way to identify the samples?

    Please have a unique identification (ID) for each sample. Please refer to the DNA section for each technology for all the necessary information to properly identify your samples.

  8. How will the genotypes be delivered?

    Data will be transmitted in our standard formats. The performance of each marker and the number of Mendelian errors will be summarized. The results will be sent as is indicated in the Request form 1 - General genotyping services. As soon as they are analysed and verified, the results will be sent to you via email or via FedEx on a CD-Rom.

  9. What are the validation and production steps?

    The validation step is the first step in the genotyping procedure. The objective of this step is to determine the optimal working conditions for your markers of interest by using a sub-group of samples. These conditions will then be used in the second step in the genotyping procedure: the production step. If no condition can be used to recuperate the markers which have failed the validation step, the client will be informed and will be asked to provide a new marker or to repeat the validation step. We will proceed to the production step only once acceptable results are obtained at the validation step.

  10. What are the validation and production genotypes?

    The validation genotypes are the genotypes obtained during the validation step. The production genotypes are the genotypes obtained during the production step.

  11. How much time is necessary for the completion of genotyping projects?

    The projects are completed on a 'first come first serve basis'. In addition, the time necessary to complete a project depends on the technology used, on the type of experiment and on the details of this experiment. Please, contact us for more information regarding how long your project will take to be completed.

Questions on the microsatellite genotyping services
  1. How are the microsatellite markers groupings done?

    The markers are put in groups of 8 in order to avoid overlap between the lengths of the fragments for two markers with the same fluorescent color.

  2. Do the selected SNPs have to be obtained from the Innovation Centre's database, Nanuq?

    No, however, it is always better to choose validated SNPs from public databases. Avoid SNPs localized in repetitive genomic regions.

  3. How should I identify the selected SNPs?

    The best way to identify your SNPs is to include the number « rs ». If it does not exist, give it a short and informative name. Avoid names containing more than 15 characters.

Questions related to methylation

Frequently asked questions and answers for this section are not yet available. You may address your questions directly to Client Management Office

Questions related to sequencing

Samples Submission
  1. How should I physically organise my samples and/or primers when I send them to the Sequencing Service?
  2. What quantity/concentration of DNA should I provide for sequencing?
  3. What quantity/concentration of primer should I provide for sequencing?
  4. What are the primers provided by the Sequencing Service?
  5. Which options should I choose when I submit my samples via Nanuq to obtain the correct form (step 1 of the submission)?
Results
  1. Once my samples have been received and accepted by the Sequencing Service how long does it take to see my sequences on Nanuq?
  2. How can I view and analyse my sequences?
  3. What length should I expect from the sequences?
  4. What can I do if my sequencing results are of poor quality?
  5. The text version of the sequence from Nanuq is different than the chromatogram. Why?
Billing
  1. Should I provide a purchase order or credit card number when submitting my samples?
  2. To whom should I send my payment?
Nanuq
  1. Which Internet browsers are compatible with Nanuq?
Answers - Questions related to sequencing
Samples Submission
  1. How should I physically organise my samples and/or primers when I send them to the Sequencing Service?

    The best way to organise samples and/or primers submitted in PCR strip tubes is to regroup all samples (plasmids, PCR products, phage or BAC) one after the other. The tubes must be properly labelled with the corresponding well ID on the Sample Submission Form: A01, A02, A03, etc.

    The primers must be aliquoted in PCR strip tubes in the same order as their associated DNA samples.

    The best way to organise samples and/or primers submitted in a 96-well plate is to regroup all samples (plasmids, PCR products, phage or BAC) one after the other starting with well A01 progressing sequentially to A02, A03 to A12, B01 to B12 and so on. The primers may be aliquoted on the same plate however they must be aliquoted after the full set of samples, beginning in the row below the last samples. If there are not enough empty wells on the plate use a new properly identified plate.

    Samples and primers must be organized in exactly the same positions as indicated in your Sample Submission Form.

    It is important to note :

    • A sample to be sequenced with more than one primer must be aliquoted in as many tubes/wells as there are different primers.
    • A single submission can contain multiple types of DNA, such as, plasmid DNA, purified and non-purified PCR product, phage and BAC DNA. The samples however must be grouped by DNA type.
    • All samples to be sequenced with primers provided by the Sequencing Service must be grouped together.

    Download examples

    You must complete plate 1 of the Sample Submission Form before beginning plate 2.

  2. What quantity/concentration of DNA should I provide for sequencing?

    Volume and concentration required per sequencing sample:

    Volume Concentration
    Unpurified PCR 20 µl minimum PCR amplifications must be verified on an agarose geland a copy of the gel picture must be sent to the sequencing service with the samples.

    PCR products of less than 250 bp result in lower quality sequences due to an oversaturation phenomenon whereby they appear much more intense than usual and to the compression of bases at the beginning of the sequencing read, which is an inherent limitation of the 3730xl technology.

    PCR products greater than 2000 bp can be difficult to sequence because the concentration of DNA submitted is generally too low. The longer the PCR products the higher DNA concentrations are required to achieve good quality sequencing.

    Purified PCR 7.5 µl minimum
    Plasmid DNA or phage 7.5 µl minimum 100-500 ng/µl
    BAC/PAC end sequencing 20 µl minimum 500 ng/µl minimum
  3. What quantity/concentration of primer should I provide for sequencing?

    Concentration and volume required per sequencing sample:

    Volume Concentration
    Primer 10 µl 5 µM
  4. What are the primers provided by the Sequencing Service?

    The Sequencing Service provides the following standard set of common primers free of charge:

    T7 5' - TAATACGACTCACTATAGGG - 3'
    T3 5' - AATTAACCCTCACTAAAGGG - 3'
    SP6 5' - TATTTAGGTGACACTATAG - 3'
    M13 forward 5' - GTAAAACGACGGCCAGT - 3'
    M13 reverse 5' - GGAAACAGCTATGACCATG - 3'
    BGH reverse 5' - TAGAAGGCACAGTCGAGG - 3'
    T7 terminateur 5' - GCTAGTTATTGCTCAGCGG - 3'
    pGEXF 5' - GGGCTGGCAAGCCACGTTTGGTG - 3'
    pGEXR 5' - CCGGGAGCTGCATGTGTCAGAGG - 3'
  5. Which options should I choose when I submit my samples via Nanuq to obtain the correct form (step 1 of the submission)?

    To the question 'What type of service is required?' answer 'DNA preparation' only if you are submitting fresh bacterial colonies or glycerol stocks. If you are submitting extracted plasmids, PCR products (purified or not), phage or BAC answer 'Sequencing'.

    Answer NO to the question 'Will you be using our SNP discovery service post sequencing?'. For more information about this service, please contact the sequencing platform's director Pierre Lepage at 514-398-3311 extension 00346 or by email.

    Lastly, answer the following question 'What kind of container(s) are you using?' and download the form.

Results
  1. Once my samples have been received and accepted by the Sequencing Service how long does it take to see my sequences on Nanuq?

    Once the samples are accepted, the normal delay for sequencing is from 2 to 4 days.

  2. How can I view and analyse my sequences?

    From your account on Nanuq's home page click on your project name listed under the heading 'Project Data/Results'. Choose the submission number corresponding to the sequences you wish to view and click on the corresponding sequencing date.

    You are now able to look at the chromatogram by clicking on 'T' (trace) or view the text version of the sequence by clicking on the length of the sequence.

    It is also possible to download the chromatogram(s) (AB1 or SCF format) or the text version of the sequence by choosing 'Search/Download Data' under the heading 'tools' in the top menu.

  3. What length should I expect from the sequences?

    Samples of good quality at the recommended concentration usually generate up to 800 bases of good quality sequence.

  4. What can I do if my sequencing results are of poor quality?

    Once you have verified the quantity and quality of your samples, do not hesitate to contact the Sequencing Service group for help.

    Sequencing Service
    514-398-3311 ext: 00522
    email

  5. The text version of the sequence from Nanuq is different than the chromatogram. Why?

    It is essential to look at the actual chromatogram to verify the quality of your sequence. The base calling program identifies all bases and occasionally misidentifies bases of poor quality, such as the first 40 bases following the primer and the end of the sequence.

    Therefore the use of the 'Mask the sequence' function is highly recommended when looking at the text version of a sequence in Nanuq. This function is listed in the menu to the left under 'Manipulation'. It masks the bases that are under a selected quality threshold (15 by default). Those bases will be replaced by an 'N'.

Billing
  1. Should I provide a purchase order or credit card number when submitting my samples?

    First and foremost, it is very important to indicate your chosen method of payment when opening an account. This is done in the Sequencing Request Form under the section 'Method of Payment'.

    If you wish to pay by cheque, the purchase order (PO) number is required for all sample submissions. Enter the PO number in row 15 of the sample submission sheet.

    If you wish to pay by credit card, it is not necessary to provide your credit card number when you are submitting samples. It will be requested upon invoicing.

  2. To whom should I send my payment?

    Click on this link to learn more about payment.

Nanuq
  1. Which Internet browsers are compatible with Nanuq?

    The main compatible Internet browsers for both MACs and PCs are:

    • Firefox version 1.0.7 and up
    • Explorer version 6.0 and up